Send IM to Anne
Send IM to Peter
 
  English | 中文
 
 
 
1
Taq Polymerase for qPCR
HotStart Taq Polymerase
Pfu DNA Polymerase
Kod DNA Polymerase
dNTPs
Reverse Transcriptase
MiniRNA Prep
First Strand cDNA Synthesis Kit
Real-Time qPCR Kit
One Step qPCR Kit
DNA Marker
Lab Consumables
Lab Equipments
SARS-CoV-2
SARS-CoV-2 IgM/IgG Antibody Rapid Test
Free 2019-nCoV Plasmids
Spin Column for  DNA/RNA
1

LinkedIn Google

Primers and probes for the detection of the new 2019 coronavirus(Sars-CoV-2) are available from ShineGene!

       
The new coronavirus (2019-nCoV) was first detected in Wuhan City, Hubei Province China. Tens of thousands of infections with 2019-nCoV have been reported in China. The virus is spreading from person-to-person in parts of the world. Coronaviruses are a large family of viruses that are common in many animals, including camels, cattle, cats, and bats. However, some animal coronaviruses can infect people and spread between people, for example MERS, SARS, and now with 2019-nCoV {CDC}. 

Corona virus outbreaks in January 2020. 
Primers and probes recommended by the CDC & WHO
ShineGene can provide the primer and probe sequences recommended by the CDC and the WHO to researchers working on the coronavirus.
The sequences were publically provided by the CDC here and the WHO here. Researchers can order these primers and probes to create a panel in their lab, following the panel instructions from the CDC. 
These materials are provided for research purposes only.
ShineGene also offer the corresponding positive plasmid.

Name Country Label 5’ Oligonucleotide Sequence (5’>3’) Label 3’ Position Working Conc. [μM]
      N Protein      
2019-nCoV_N1-F USA   GACCCCAAAATCAGCGAAAT   28287-28306 20
2019-nCoV_N1-R   TCTGGTTACTGCCAGTTGAATCTG   28335-28358 20
2019-nCoV_N1-P FAM ACCCCGCATTACGTTTGGTGGACC BHQ1 28309--28332 5
2019-nCoV_N2-F   TTACAAACATTGGCCGCAAA   29164-29183 20
2019-nCoV_N2-R   GCGCGACATTCCGAAGAA   29213-29230 20
2019-nCoV_N2-P FAM ACAATTTGCCCCCAGCGCTTCAG BHQ1 29188--29210 5
2019-nCoV_N3-F   GGGAGCCTTGAATACACCAAAA   28681-28702 20
2019-nCoV_N3-R   TGTAGCACGATTGCAGCATTG   28732-28752 20
2019-nCoV_N3-P FAM AYCACATTGGCACCCGCAATCCTG BHQ1 28706-28727  5
2019-nCoV-NF China   GGGGAACTTCTCCTGCTAGAAT   28881-28902 0.6
2019-nCoV-NR   CAGACATTTTGCTCTCAAGCTG   28958-28979 0.8
2019-nCoV-NP FAM TTGCTGCTGCTTGACAGATT TAMRA 28934-28953 0.1
HKU-NF Hong Kong   TAATCAGACAAGGAACTGATTA   29145-29166 0.6
HKU-NR   CGAAGGTGTGACTTCCATG   29236-29254 0.8
HKU-NP FAM GCAAATTGTGCAATTTGCGG TAMRA 29196-29177 0.1
NIID_2019-nCOV_N_F2 Japanese   AAATTTTGGGGACCAGGAAC   29142-29161 0.5
NIID_2019-nCOV_N_R2   TGGCAGCTGTGTAGGTCAAC   29280-29299 0.7
NIID_2019-nCOV_N_P2 FAM ATGTCGCGCATTGGCATGGA BHQ1 29239-29258 0.2
WH-NIC N-F  Thailand   CGTTTGGTGGACCCTCAGAT   28320-28339 0.4
WH-NIC N-R   CCCCACTGCGTTCTCCATT   28358-28376 0.4
WH-NIC N-P FAM CAACTGGCAGTAACCA MGB 28341-38356 0.1
      E gene      
E_Sarbeco_F1 Germany   ACAGGTACGTTAATAGTTAATAGCGT   26269-26294 0.4
E_Sarbeco_R2   ATATTGCAGCAGTACGCACACA   26360-26381 0.4
E_Sarbeco_P1 FAM ACACTAGCCATCCTTACTGCGCTTCG BHQ1 26332-26357 0.2
CoV-EFP China   ACTTCTTTTTCTTGCTTTCGTGGT   26295-26318 20
CoV-ERP   GCAGCAGTACGCACACAATC   26357-26376 20
CoV-EP FAM CTAGTTACACTAGCCATCCTTACTGC BHQ1 26326-26351 5
      ORF1ab      
2019-nCoV-OFP China   CCCTGTGGGTTTTACACTTAA   13342-13362 0.6
2019-nCoV-ORP   ACGATTGTGCATCAGCTGA   13442-13460 0.8
2019-nCoV-OP FAM CCGTCTGCGGTATGTGGAAAGGTTATGG BHQ1 13377--13404 0.1
HKU-ORF1b-nsp14F Hong Kong   TGGGGYTTTACRGGTAACCT   18778-18797 0.6
HKU- ORF1b-nsp14R   AACRCGCTTAACAAAGCACTC   18889-18909 0.8
HKU-ORF1b-nsp141P FAM TAGTTGTGATGCWATCATGACTAG TAMRA 18849--18872 0.1
RdRP_SARSr-F2 Germany   GTGARATGGTCATGTGTGGCGG   15431-15452 0.6
RdRP_SARSr-R1   CARATGTTAAASACACTATTAGCATA   15435-15460 0.8
RdRP_SARSr-P2 FAM CAGGTGGAACCTCATCAGGAGATGC BHQ1 15470-15494 0.1
Name   Label 5’ Oligonucleotide Sequence (5’>3’) Label 3’   Working Conc. [μM]
Internal standard     RNAse Protein/NM_006413.5      
RP-F Recognized   AGATTTGGACCTGCGAGCG   28-46 20
RP-R   GAGCGGCTGTCTCCACAAGT   73-92 20
RP-P RNAse P FAM TTCTGACCTGAAGGCTCTGCGCG BHQ1 49-71 5


Note:
In order to prevent any cross-contamination of primers and probes with control plasmids, our standard procedure is to spatially separated our production of oligos and genes/plasmisds by separate rooms and  air systems!
Publications
1.
(2020) 2019 Novel Coronavirus (2019-nCoV), Wuhan, China. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
2.(2020) 2019-Novel coronavirus (2019-nCoV) real-time rRT-PCR panel primers and probes. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
3.(2020) Real-time RT-PCR panel for detection 2019-novel coronavirus. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
4.(2020) Emergency use authorization. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].



If you want to get bulk order price,please contact us.E-mail:master@shinegene.org.cn or shinegene@vip.163.com

LinkedIn Google

Related Link
SARS-CoV-2 Primer and Probe
Oligo Synthesis
Taqman probe
Peptide Synthesis
Chromas
Make Antibody
Lab Consumables
Gene Synthesis
dNTP


 

 

Copyright 2003-2020 Shanghai ShineGene Molecular Biotech,Inc. All Rights Reserved.
Floor 2,Gate 6,289#,Minqiang Road,Songjiang District,Shanghai 201612,China
Tel:0086-21-54460832    Fax:0086-21-54460831-13    E-mail:master@shinegene.org.cn